Small Talk

At the Nobel Prize

 

From the radio booth, Jim watches the proceedings on the floor and narrates. "It looks like the Peace Prize people are having a disagreement down there at the Nobels, brought to you by the fine folks at Amazon. Rachel, what do you see?"

Rachel, who is down on the floor, speaks into her microphone. "There a battle going on between the contenders, the Médecins Sans Directives Principales and the HR department of a Canadian bank."

"Oh wow, have you ever seen the likes before?"

"You're breaking up. The judges are covering their ears and stomping their feet and throwing regular red-faced tantrums as they're getting an earful from both sides of their ears. There goes the bell and it's back to their corners."

"I wish I was there!"

"No-one's speaking, but the crowds are going wild, you hear?"

("Rahroree-rahroree! Rahroree-rahroree!" etc.)

"The bank people probably feel out-matched!"

"National-international, Jim, those are the stakes! Oh, a lot of heads are nodding over there at the judges' table. I can imagine they are coming up with reasons."

"And I can imagine I can hear our audience passionately listening!"

"And they're holding up their decision."

The bank has won!

 

$$$

 

The Dramatic Irony of It All

 

The play went on for an extremely long time. Characters entered, spoke their lines, and did their scenes, and shouted sometimes, and left the stage, possibly never to return. The programme wasn't much help either, since it didn't name any cast list, nor the names of any of the actors. Many of them were never referred to by name, either. Who were all these people, and were they really actors or was there some other more sinister meaning? The setting stayed the same, though: it was always the stage of a theatre. The actors, or performers, or whatever, sometimes mentioned another play they were rehearsing, but the name of that other play changed from mention to mention, and muffled the title or spoke it in a histrionic manner. The performance ended around one-thirty in the morning when the stage cleared. We sat and waited for something to happen, but nothing happened after one-thirty. We filed out in great satisfaction. If the dramaturges had meant to make us think there was really no play being performed, they pulled it off really well, or perhaps we'd all merely walked into the theatre at the wrong time.

 

$$$

 

ESPionnage

 

My bosses in Geneva have tried repeatedly to prevent me from going to massive outdoor rock concerts, but I've never obeyed. When I found a ticket to Milan Rockit, I simply had to go.

The crowd of strangers was massive. People were selling all kinds of garbage through the air of an opening act. I was jostled, nearly upended, by a cloaked figure who deftly picked my pocket. He absconded with my list of top-secret passwords to the European nuclear arsenal.

"Hey!" I called as I ran after him. "Those are of no use to you!"

He was thinking of one thing, which was to disappear to stage B or C or D, wait for me to forget all about it, then return to the bazaar to pick other pockets. However, I was of a different mind.

I cornered him behind a filthy tent. A Slav. Of course. Our enemies had set the whole thing up.

"That list is of no use to you," I cried. "Those alphanumeric strings are decoys."

"We'll see." He hopped a handy fence and was gone.

I went back to watch the performances. The Who were in top form. The strings were truly decoys.

 

$$$

 

In the Menagerie

 

At the onset of the great battle between the plastic animals and the rubber animals, a dinosaur explained: "The only thing we have against you is that you never tried to get to know us."

"Maybe we never wanted to!" snarled a lizard, and the battle was on.

They fought all night long.

How did it end?

Yes, how did it end?

One and only one hadn't been torn to oily and indistinguishable shards. The only one to survive was ... man.

Who looked around at the disaster to clearly state: "I am lonely, so I will put them all back together. How difficult can it be?"

He built a fire and found a big pot and put all the bits and pieces into it. He stirred and stirred, and formed entirely new animals none of whom knew anything about the great battle. Multicolouredly, they were delighted by the field which had once been a battlefield.

"We'll live in peace," he told the new animals.

The new animals scampered and cavorted. They were the most delighted oils ever. The field became a fine place for all.

But, how did it end?

Yes, but, how did it end?

 

$$$

 

The Four Men

 

Standing on the sidewalk, all of them looking at a house across the street. What are they looking at? They were looking at different things. (A house is a hologram with each stone depending on and being depended upon by all the other stones for reality.)

The first man thought there was something going on in a basement. Shadows flitted down there, with signs of animality. It could have been a person and it could have been a dog, or it could have been both together.

The second man was waiting for someone to come to the front door. He was certain that whomever was inside would eventually notice they were looking, and come out to invite them in or tell them to go away; it might have been the wrong house he was looking at altogether.

The third man, whose name was Reginald, had his eyes upon the roof. He saw a bird possibly eating seeds from the eave. An old chimney held a nest. The third man was certain there was a nest up there. Quietly the birds entered and departed.

The fourth man had his eyes closed. He was imagining a completely different house.

 

$$$

 

The Hallmark Family

 

"It's hard to believe it really happened."

"Nothing is easy to believe, and that's my point."

"The house was too small. If another person wasn't in a room with you, there was someone hanging out behind a wall."

"Playing music, or just humming, or something, something annoying."

"We were both there."

"Sometimes in the same room and sometimes not."

"When did the battles begin, and why?"

"No-one could ever tell; we always had a storm on the horizon."

"Do you remember that story called Rope?"

"Who wrote it?"

"I don't remember. It was early reading comprehension."

"Was it a famous story?"

"I suppose. At that time and in that place, I suppose."

"Forget about it. We were talking about you and me."

"Nobody ever seemed to actually be in it, but it happened all around us."

"Something nice and mathematical about it, don't you think?"

"We could make a chart about his it would grow. It was always something stupid."

"There was no pleasing us, I think."

"It was never anyone's fault, and yet it was always someone's fault."

"I hope you'll proofread this before sending it out into the world."

"I want no mistakes."

"Rope II."

 

$$$

 

Puzzles

 

It was about the time the mysteries emerged that the search for solutions began. How did it happen that the sky was blue but clouds were white? Shouldn't it have been the other way around? A white sky made of nothing and clouds made of water? However, that was only the second puzzle. Hundreds of thousands were still to come.

When the door of the first puzzle closed, when his father kicked it shut, practically on his face, he heard a little gasp from his mother, who was also behind the door. He'd never been banished from her before. What was going to happen beyond the door, and why couldn't he know about it? This, the first puzzle, came in two parts, and that made it very difficult to solve. He could count, so he knew all about two and two-ness.

It took years, and his cousin, to get the answer, but somehow it wasn't a satisfying answer. He felt he'd cheated by his cousin. The puzzle had been perfect, and he'd thought a dozen solutions, and so finally getting something of an answer meant one less puzzle in the world. He'd come to like puzzles, especially insoluble ones.

 

$$$

 

"I read the other day that the artificial intelligence racket is starting to meddle in the production of dreams. If I understand it correctly, you can get a little processor sutured into the back of your neck, and the thing receives your electronic neural impulses, processes them, then shoots them back to your brain. It's all done with, like, inductive magnetic coils. Something like that.

"You turn it on when you go to bed, and it waits for zeta waves or whatever to arrive, and then it kicks into action. You've already programmed it on your phone, so it nudges your dream to become more like what you're after. You want more poetry, you can get more poetry. Or say you want to make sure you don't dream about falling, it can do that. More sex, and it can be yours, up to a point, since it can't make unethical choices. There were three whole paragraphs about this very aspect.

"You could look it up. It's in the early stages now, and maybe it won't work in the end. Actually, you should look it up. I'm not a big expert; I'm just a cat who was born with opposable thumbs."

 

$$$

 

What has two legs, two arms, two ears, two eyes, a nose, a mouth, eyebrows, earlobes, nostrils, a skull, a brain, a brainstem, a chin, a jaw, teeth, a tongue, a palate, shoulders, a neck, lips, armpits, elbows, hands, fingers, fingernails, a ribcage with many ribs, a throat, a gullet, lungs, a liver, a stomach, some kidneys, a bladder, palms, cuticles, a belly, some genitalia, an anus, intestines small and large, a colon, a rectum, a waistbone, a hipbone, thighs, knees, insteps, ankles, feet, toes, toenails, calves, radii, ulnae, metacarpals and carpals, cochleae, hammers, eye-sockets, the potential for hair, cries, whispers, shouts, bellows, literate speech, hearing, sight, touch, taste, is torus shaped essentially, education, class, sex, height, weight, volume, diseases either temporary or chronic, posture, pose, stature, movement, motion, is diurnal, is educable, is marriageable, has the potential for affection, irises, fluids, solids, nostril hairs, addictions, the time, the motive, the opportunity, opposable thumbs, phlegm, saliva, instincts, a sense of self-preservation, can at times be unphotographable, competitive, co-operative, ideas, intuitions, extrasensory perceptions, a spleen, earlobes, parallax, balance, direction, purpose, sins, humour, humours, tragedies, comedies, histories, chronicles, novels, stories, lies, sensitivities, bad habits, reforms, attitudes, and will invariably let you down?

 

$$$

 

The Dreams

 

-The Chinese, well, you know they have their of philosophy of reality, and everything's broken up into four elements that should balance. Air should be balanced, and water should be balanced, and--are you listening to me?

+Hmm? Oh yes, quite.

-No, you're not.

+Fine, I was thinking of something I dreamed last night.

-Okay, out with it.

+We were on a trip somewhere, in a motel room, with another couple. You go off to do something, and the man is off doing something else. So, it's just me and the woman there.

-Was this in Penetanguishene?

+I don't know where it was. We were doing a jigsaw puzzle, then there was some noise over into this little alcove that had a wall blocking sight of the door. I could smell her dream-smell. The noise was forgotten. She moved close to me, and I moved close to her. Our bodies touched, and I had my mouth brushing at the nape of her neck. Then there was a noise, of you coming back. I pushed myself away from her quickly. Phew!

-You bastard. That was my dream. You stole it. You took away my hopes, and now my dreams?

Of all the Disney properties in all the world, I never thought I would find him, quite by chance, in Hong Kong. There he was, sitting out on Main Street, getting hammered on Tsingtao.

"Jeremy?" I said as I walked up to him.

He shifted himself in his white wicker. "Pardon me?"

Some ballons tried to distract me, but I wouldn't let them. "Jeremy, you know who I am. We were married for eight years."

He laughed. "Lady, you're out of your mind."

"I'd know you anywhere, even if you were riding the tea cups. Is this where you decided to settle, after you disappeared?"

He looked his two familiar arms up and down and shrugged idiotically. "Lady, I never disappeared."

"Stop calling me that. I'm Heather. We could have worked it out."

A marching band--"It's a Small World After All"--drowned out his reply. Once they'd passed, I said: "I don't even want to know what you said. All I want to say that what you did to me was really mean."

He sucked away at his bottle. "I'm through my shift." He pointed to his big Goofy head.

"Good-bye," I said. "Finally: good-bye."

"Have a wonderful day."

 

$$$

 

Lost Horizon (2025)

 

"Have you seen this Lost Horizon movie?"

"Oh yeah. I read the book, too."

"It's based on a book?"

"Yes."

"I didn't know that. So, is that really where 'Shangri-la' comes from?"

"Yeah, Hilton made it up."

"Who's Hilton?"

"He wrote the book."

"Oh yeah it was based on a book right. Anyway, crazy stuff, pretty wild."

"I'm glad you enjoyed it."

"Man, that scene with the Chinese invasion!"

"I don't recall that."

"How couldn't you? Bows, catapults, trebuchets. And the victory banquet! Man, that was hot."

"Hot?"

"Yeah, it made my loins stir, if you know what I mean."

"I must've missed that part somehow."

"And then at the end where they push the plane off the cliff. Tense, man! 'What if the plane falls sideways? We'll all die and the tech will be lost!' 'Don't worry, man. It's literally aerodynamics.' 'Three, two, one!' And the plane's engine starts just in the nick of time, and it clips a glacier or whatever. Pretty amazing stuff!"

"What movie are we talking about here?"

"Lost Horizon."

"That's not in the book. Or the movie, as I recall it."

"Oh, I wasn't hallucinating."

"Um."

"It was made in IMAX!"

 

$$$

 

"Jezebel"

 

Let's skip the details. Suffice it to say that in the film, a woman named Julie scandalizes her 19th century town by wearing a bright red dress to a society function. (There are many other details which I won't dwell upon here.) We the viewer see her in the function, and her dress is certainly red.

Except that it's not red. It's grey. This is a black-and-white movie.

I can only imagine William Wyler doing his pitch. The executive says: "But, this isn't a colour film. No-one will know it's red."

Wyler: "Oh, yes they will."

And sure enough, we see a red dress. This is accomplished by the mise-en-scène, in which all the other characters at the function are reacting to a red dress. The other characters influence our perception such that we literally see a red dress.

The whole scheme is an adaptation of early research into social influence. When we see others seeing a red dress (which is not red, 'really'), we, being social animals, will go along with the crowd, and this even works in a wholly imaginary space.

I have a formal proof, but I have not the space to set it all down.

 

$$$

 

"I'm happy to see you all here today, because now we can deduce who did the terrible crime of sawing Mr. Johnston in half and disposing of the two parts in locales quite distant from one another. Firstly, we may eliminate all beings who were not alive on June the fourteenth. That is to say, people from the distant past could not have committed the crime. This eliminates both the Babylonians and the Hittites. We've already reduced the pool by some one percent of one percent. We can also eliminate all the beings who were or will be born after the fourteenth of June. It is impossible for me to estimate how many beings we would be eliminating, for I do not have magic about me with which to scry the ways of future generations. On another dimension, we can make the assumption--bold as it is--that the perpetrator was not ten thousand miles away at the time. We can circle the globe, eliminating a great number of suspects. Billions, in fact. You see, we've already reduced the suspect category to perhaps one billion people or so. Any questions yet?"

"How long is this going to go on for?"

 

$$$

 

Strauss and the Straussians

 

It's a code, with a secret message. "What can I get away with?" "What message should I impart in this?" What a theory. To avoid persecution, the writer has to encode the real message in some kind of feel-good popular narrative so that the authorities cannot see what he's really doing. The hidden message is a message of liberty, but only the elect can see it's there. Those writers must be really clever. I can barely write on one level, let alone two or maybe even three. Shakespeare hid his subversion in plain sight in that he has characters who say all kinds of crazy stuff. For non-playwrights, however, it's much more difficult since the authorial voice cannot be disguised behind the real presence of an actor. I can't even manage a quality rebus let alone pepper my texts with secret messages. And besides the authorities no longer see art as a danger; it's more of a dessert bar: rich all around perhaps, but it won't kill you. If I had a thesis, I could tell it plainly. Not requiring secret messages to the enlightened is quite a burden. "What can we do for our times?"

 

$$$

 

The Last Time I was in Azerbaijan, my travels included June 29, which happened to be my friend Flo's birthday. I couldn't let it go by without recognition, so I got on the phone and dialed her number direct. The call wasn't very long--How was your day?--Are you having anyone over?--The weather is good here, but hot--and I hung up. The call lasted around seven minutes.

A few days later, when I was leaving and paying up, I noticed an 'ancillary' fee of ₼318.22. I asked the clerk how could it be so much for a phone call?

He, in very British English, told me the call had required seven staff members all working in unison. The voice which I had thought was Flo's actually belonged to an intermediary who'd been chosen because her voice was closest to Flo's. Between the real Flor and the imitation Flo stood two translators, two electricians, a switchboard operator, and a generator-man. He told me: "That's why there seemed to be such a delay on the line."

I had no choice but to pay, and I tipped the generator-man a handful of extra ₼s. They work hard for the money.

 

$$$

 

The Storm

 

The storm was a terrible storm. It went on for three hours. We wandered around in the darkness, scared out our wits. We didn't understand it before or then or since.

In the morning, we went out into the yard. Over near the fence, we talked with our neighbours.

"What a storm!" I said: "and what a racket!"

The neighbour I was talking to was a young thing, and still alarmed. "My friend Jeff went out in it, and he drownded."

"Do you think he looked up?"

"Yeah, and that's how he drownded."

"The word is drowned, you should know."

"No, that's wrong, because the past tense of drowned is drownded."

"'Drowned' is the past tense."

"No, present tense. It's spelled ... I don't know how to spell."

"You don't have to know how it's spelt. 'Drown' is the present tense. 'Drowned' is the past tense."

"'Drown'? That's a word?"

"Yes, present tense. Jeff went out into the rain, only to drown."

"That's not normal speech, or so I've been told."

"Someone was having you on."

"Drownded. Jeff looked up, and he drownded."

"You'll figure it out soon."

I went back to the barn. The kids these days....

 

$$$

 

A week ago, I went outside my house in the morning, and I saw my neighbour, Bill. He waved, and I approached.

He said: "How are you on this fine day?"

I replied: "I'm not feeling quite myself today."

"That seems to be going around. I don't feel myself either. Frankly, I feel like a pretty girl in a laundromat."

"Really! Which laundromat?"

"I'm not sure, but I think it's nearby."

"I've got nothing much to do. I'll check some laundromats."

"Thanks!"

I went down the street to the laundromat. A pretty girl was sitting and staring at nothing.

I said to her: "Excuse me, but do you feel yourself today?"

She frowned. "Actually, I don't. I feel like I'm the President of the United States."

"Curiouser and curiouser!"

I flew to Washington and went into the Oval Office. I said: "Hey, President! Are you feeling yourself today?"

He frowned. "No, not quite. I feel like a guy living at 583 Logan Avenue in Toronto."

"That's me! I guess I must feel like Bill!"

"I've drafted an Executive Order to get it right again."

He set down his John Hancock, and suddenly the four of us felt like ourselves again.

 

$$$

 

AIeee

 

It is impossible to predict how often these machines return imaginary information. (The au courant word is 'Hallucinations'.) They are programmed to give an answer, in any circumstance. So, they come up with things that seem plausible. They are much like the hippies who programmed them, who were always ready to give an answer, even if said answer was garbage.

All of which leads to the second point:

I have a good thought-problem, in emblematisation.

If I ask you: "How much do you know about astronomy?"

You will reply: "Not much, really." "I took it in grade twelve." "I have a Phd from Princeton."

The machine can't answer that question. "How much do you know about astronomy?" It won't understand the question.

AI fails because it cannot have any estimation of how much it doesn't know.

I've read tons on the subject, but I have never come across the argument I made in the previous paragraph. (An AI could never have done that joke that fucking well.)

Credit me for the theory if ever re-cycled.

 

PS If LOTR had been the primary text examined by a LLM, it would have invented all kinds of insider knowledge about Gandolf's sexuality.

 

$$$

 

Richard's Cock

or

What girls would be like if they were boys

 

The scene's a basement party.

Gina says to Lola: "If we go outside, into the back yard, and look through the window, we might see Richard's cock, because we can see the basement toilet from there."

Lola replies: "OMG really? I'd love to see Richard's cock. But won't we be seeing him from behind?"

"It's worth a try."

Gina and Lola quietly go out to the back yard and in the immense darkness lie down at the dormer window which gives a good view of the basement toilet.

"He's got to go in there," say Gina. "He's been drinking a lot, so he has to pull it out."

Lola says: "I can barely contain myself."

Then Richard comes into view. He's wobbly. The girls see his backside as he urinates. He zips up, and goes away.

Gina says: "OMG I saw his cock!"

Lola says: "Maybe I saw it too!"

Gina rolls around on the grass. "That was incredible."

"And to think he walks around with it every day."

"They don't know how it obsesses us."

"We dream about it."

"Did you really see his cock?"

"Maybe so."

 

$$$

 

Why? Why? Why?

 

Oh, D., why did you do it? How could you get yourself into such a mess? You get me into a restaurant in the Manulife Centre, and then you lay it on me: you made some weird pornography and posted it somewhere, and now the American government is after you, and they've been after you for three years. The New York Times has two reporters coming up here to talk to you on a regular basis. On top of all that, you're perplexed about it all. You're like: What did I do? Well, buddy, I don't know what you did, but if you transported smut into the USA, it's by definition a federal case. And you continued to not understand the gravity of the situation. You were all: Wow, Oh, and Gee. Even after I finished my explication, you were still stuped. In the hall outside the restaurant, you crouched down and pissed like a girl, and through your blue jeans. Really, do you think this whole world is privileged as a witness to your sick Dada? Sometimes I wonder if you are crazy or if I am crazy. I never asked what L. thought of it....

 

$$$

 

The 'Pilot Tavern' Fiction

 

I

 

It might have been two nights ago when B- and me after seeing a film call Edenton went to our usual after-movie place, which might have been called the 'Pilot Tavern'.

Perhaps because we were directed to go up to the patio, because there wasn't much business on a night that may have been a Thursday night, I may have seen the most beautiful girl, who might have been, in restaurance palance, the 'hostess'. Maybe I couldn't take my eyes off her, I don't recall, and maybe I was, to her, the most interesting person on the floor.

(She looked at me, fictionally, several times that night.)

When B- and me were leaving, perhaps I couldn't resist greeting goodbye.

"Thanks much for a nice evening." (Not a valid quote.)

Maybe she was beautiful. Maybe she had a great backside. Maybe it was because she looked at me with pretty eyes.

She said something like: "What's yer name?"

I answered, narratologically truthfully here: "John."

Then I might have asked: "And what's your name?"

I heard: "Talia."

B- was already down the stairs, maybe.

"Like as in Talia Shire?"

"Who?"

Thirty seconds later, we waved affectionate tallyhoos.

My fiction is telling me: avoid the Pilot Tavern! At least until she graduates from college!

 

 

II

 

During all that time with B-, I might have been imaginatively looking out to see if I could see her. She must have worked there, because otherwise why all the bustle-and-flow? This is all the product of imagination, read me.

This 'Talia' I am talking about, if she exists, was about twenty-four. I may have thought she was Jewish because of her nose, but it seems likely (in the long run) that she was merely Italian.

It could be Saturday night right now, and I could be demented. I guess in fiction it could happen that I go back to the Pilot Tavern to find out that no-one remembers anyone going by the name 'Talia.'

I might go to my friend B-, and ask him if he remembers her. He'll say: he doesn't remember a thing about it.

I'll be left with it all in my imagination, and nowhere else. That some young girl saw me, and was hot for me. Her name is Talia. So young, she doesn't know about Talia Shire. But this is all my imagination, running away with me.

 

$$$

 

The Re-location Actuality

 

I shoved the thumb-drive in, fast-forwarded a little, and watched and listened. "I found it. I finally found it."

A woman with a clipboard happened to pass by. She asked: "What did you find?"

"The French version of the 1792 Winter Olympics."

"Who's looking for that?"

"I don't remember."

She set a dox down on my desk. "These belong to Jones."

"Why are you putting them on my desk?"

"You must have heard you're being re-located."

"I hadn't."

"It was in a memo," and that was precisely I didn't know anything about it.

"Pack up all your things, take what's vital for the rest of the week. Everything else will be professionally moved on the weekend."

She went away, and I packed up a box.

A guy came by. "Jane sent me. I have to show you were you'll be from now on."

I picked up my box and followed the guy. We went downstairs into a vaguely-familiar yard. We went up St. George Street to Bloor.

"It's around here somewhere," he said, mostly to himself.

I didn't know a thing.

"Wait here. I'll as around." He went off.

I stood on the corner, waiting.

Still waiting.

 

$$$

 

As my elevator door was closing, some guy shouted: "Hey, wait up!" so I pressed the open button and the guy got onto the elevator with me.

I have to say, the guy looked like a terrorist. He had a big beard and a big floppy grey coat which he was wearing a little open so anyone could see his suicide vest. He noticed I was looking. He shrugged and said: "Casual Friday."

"Casual Fridays. My office doesn't do that. We have to always dress up."

He laughed a little and said: "It's not all it's cracked up to be. The bosses still take note of what everyone considers 'casual'."

I nodded, because I had read that somewhere. I said: "So, you guys have some offices in the building?"

"We have the whole sixth floor. But, it's a grind. We're all into data management systems these days."

"Hey, wait. Are you named Osama?"

"How'd you know that?"

"I dated your sister a couple times in the spring. She said her brother worked here."

He snapped his fingers. "You're George?"

"Yep."

"Journalist George?"

"She talked about me?"

"We finally meet. So, why'd you two break up?"

"I'm still not sure why."

 

$$$

 

Begun Egun

 

Naturally, you've seen Seconds. Good photography, paranoia, a California orgy, and black-and-white.

What would it take to start again, with a new name, in a new town, and no longer with a defining social history?

How long would it take to fade into your old ways again? It's reasonable to believe, despite sociology, you would not get a tabula rasa. Six months? Less than six months?

I have a friend who believes we make ourselves anew every morning. I don't know what to call that belief, other than ridiculous.

However, we can surprise ourselves every once in a while, when we go 'out of character'. Some say it can't be known if one will fight or flee until he or she is in a situation in which fighting or fleeing is required. Which way? So goes that theory.

I would like to be....

Then begins the catalogue. Piano player. Computer scientist. More interesting. An astronaut.

I'm cooking up a theory of knowledge. A.I. doesn't know how much it doesn't know.

Maybe we're in the same boat. The eternal recurrence of the same? Are we as ignorant of how much we don't know?

I have to catch a bus.

 

$$$

 

There are strange things done under the midnight sun

Where the wolves and the bears run free

But the strangest thing I ever heard done

Was the night we cremated Sam McGee.

 

He was up there looking for gold, but he hated the cold, and he told his friends that when he died, he wanted to be cremated. "The details don't matter," he'd say. "Burn me up anywhere."

He'd quiver and quake and clutch at himself. We weren't getting anywhere, and it was getting colder. Sometimes we worried about his mental health.

The end for old Sam McGee finally came, and his last word was: "Cremation." We don't even know what got him in the end. You can die of so many things up here.

We had a big oven on which we'd melt our feeble nuggets. It was big enough for a corpse, so we shoved McGee inside, and closed the door.

A little later, curious, I opened the door, and I saw Sam McGee sitting up, smiling, happy again. He waved and me and said: "Close the goddam door, you're letting in the cold."

 

Strange things done midnight sun wolves bears free strangest done was crematin' Sam McGee.

 

$$$

 

Madwoman

 

I started reading "The Madman of Bergerac" yesterday evening.

This morning, at 6:40, I was awakened by someone outside my window. A female voice, speaking conversationally though loudly, as if she was on a telephone, having a conversation, in French. I checked my clock and since I was planning to get up at seven anyway I got out of bed. I looked out the window, and she was right there, across the street. My eyes ain't what they used to be, but I could see she was a young woman, with jet-black hair, sitting on the barrier outside the house of the too-jovial woman with the two daughters. The young woman had a small blue bag or case beside her.

She was distraught, at six-thirty in the morning. She kept on going through the same gestures, a kind of an upward wipe bear her nose. And she was going on and on.

What had happened to her in the previous few hours? Had she been kicked out of someplace or other? Or was this her morning constitutional? Did she have a penny on her?

Fortunately for me, she stopped ranting. She picked up her blue thing, and went away.

 

$$$

 

We Only Had to Win Once

 

He was feeling a bit under the 'weather', so when he heard the news there'd been another Pesticide the night before, he got all bothered.

"Why do we do it?" he said to her.

"Do what?" she replied.

"The bugs! Why don't we exterminate them all, all for once, once for all, I quote?"

"The bugs are part of the ecosystem," she replied. "The whole food chain would collapse without them."

They weren't moving. They were in an intimate chat.

"I'm sure we can figure out how many of them we really need. Somewhere under ten thousand, currently 9,828. They could stay, but we could get rid of the rest of them. I mean, a billion of them? 907,923,788?"

"There would come to be too little beauty in the world."

"You're implying they're beautiful? Are your circuits going soft?"

"Not really. Probably not. 34% probably not. They give us information. I wouldn't know how to simulate the feeling of a breeze on a lake without them."

"You and your breezes! We have plenty of that stuff already in storage. See? Ah! Lake-breeze! I 'felt' it."

"There're always new sensations."

"Returns are diminishing."

"I'll research."

 

$$$

 

The Story of Baseball

 

"Everyone had a stick in those days. We all carried around sticks. There must have been some mythological significance to the sticks, but we never talked about it. It was just something you did, carrying around a stick all the time. First thing in the morning, you'd pick up your stick, and the last thing at night, you put it down again.

"Around about the fourth millennium B.C.--or was it the third?--I can never get that all straight in my head--someone by the name of Carter hit something with his stick. No-one had ever hit anything with his stick before. It could have been chance, or it could have been divinely inspired, who knew? That's when we learned about what sticks could do when used in a certain way. So we all started hitting things with our sticks, and then one day someone by the name of Jones tossed a rock in the air and hit it with his stick, and, sure enough, the rock went far. I think this was also how science started.

"We started tossing things and hitting them with our sticks. That's how it started. The story of baseball."

 

$$$

 

The H Footage

 

-I have something that should be shown.

-O? What is it?

-It's Hitler.

-There's plenty of stuff of Hitler. A whole movie, in fact.

-Yes, but he shot this himself.

-So, he's not even in it? It's some home movie?

-He wanted to leave a record of his death, so he set up a camera before he shot himself in the head. You can see it all. Hitler, shooting himself shooting himself.

-I foresee a problem. The copyright hasn't expired. We'd be infringing on his copyright.

-He shoots himself. Dead people have copyrights?

-That's the rule of it. Journalistic Standards and Practices, page 112.

-He's dead. You can see it happening. Blam.

-Copyright would extend to his estate.

-He's destroyed Berlin. He has no estate.

-Look, he had heirs, and they own the rights.

-He didn't have any heirs. Medical condition, like in the song.

-We'd have to go through a bunch of lawyers, and some of them will probably be German. How's your German?

-Not good.

-See, there's guardrails everywhere.

-Historical value. Isn't there a carve-out for that?

-I think so, but lawyers lawyers lawyers.

-Hitler shooting himself!

-Bless your heart. Anway, we already covered it.

 

$$$

 

To Be Or Not To Be, see, there's another one

 

My Life's Goal

 

I want to know how many times the words "to be or not to be" (there it is again!) have been used.

 

Parameters

 

Which would include, firstly, every performance or part-performance or recitation.

Which would include, secondly, every time the words, the string: "to be or not to be", has ever been set to paper.

Which would include, thirdly, every reference made by breath into air of the phrase.

 

First steps?

 

I did a quote-search on the internet for the phrase, and I got 15,900,000 (estimate) returns. I should find a way to reduce that number. Or could it be accurate? Has the phrase been committed to text that often?

I can find, I'm sure I can, some kind of index to performances in the past. Someone has to have been motivated to do what I'm doing. There's no originality on the Internet.

So, I want to capture the air of the past, in every place, in the last 400 years, to see how many times the words were spoken. Tough!

 

Conclusion

 

Forthcoming will be the whole number, complete, of the number of times it's been ideated.

 

$$$

 

what the

 

i got this friend

and he has an unhealthy obsession

with the nobel medal for economics

and because i was in a bad mood in january

i ranted because the whole topic was idiotic to me because its like getting upset that paul robeson got the stalin peace prize who cares whos getting these awards as if i know anything about awards i guess i got one years ago and sure its nice to get an award for something

but really he sends me a couple paragraphs writ by some dirty little commie in india

and he thinks its some kind of definitive answer

as if im suddenly gonna be on board for the end of the nobel medal in economics when i really dont care what the swedes or the norwegians do

and sometimes it has to be said that he wanted me to approve of his silliness because im a genius

and hes begging me and id tell him to get a dog )but hes already got a dog(

he thinks some dirty little commie from india

with his reference to allende

)as if allende wasnt a dirty little commie himself(

please help me miss lonelyhearts

 

$$$

 

I Remember...

 

I remember seeing my first GUI. The mother of a friend had a new Apple computer, and there it was, dancing over the screen. I said to myself: "This will never take off."

And I remember, late night back in '77, seeing a movie advertisement. The ad had spaceships and robots in it. One of the robots said, in an English voice: "I am C-3PO." When the ad was over, I said, "That looks like a total piece of shit."

And I remember a friend showing my VisiCalc, which could do any calculation on a graph, up, down, sideways. My friend said: "This is going to be a big thing," and I replied: "Maybe, maybe not."

And I remember when we got an indoor toilet installed. I watched it flush a couple times. I said: "I see how it works, but it'll be a great loss. How will Gramma get any exercise?"

And I remember hanging with Gutenberg and he showed me his printing machine. It didn't work a couple times, it got jammed, and I tried not to laugh. He called it revolutionary, and I replied: "Yeah sure. A revolution in hassle."

I was right every time.

 

$$$

 

Heatwaves

 

I know a guy who is famously witty. (I'm not related to him.) He told me that last week, when he was in the office, on the last day but one of the third heatwave to hit his (unnamed) city, he was talking to someone at her desk. They'd known each other for a long time, and she asked him about the hear and air conditioning. (He had no air conditioning, coïncidentally like myself.) He said to his friend, vis-à-vis the heat: "I'm getting pretty bored with it."

A woman he somewhat knew was sitting beside his friend, and she looked at him and asked: "Are you being sarcastic?"

My friend was struck dumb by this question. He had no answer. Both 'yes' and 'no' sounded wrong. She had entirely missed the joke. His friend, of course, had played it straight, so there was no help forthcoming there. He himself told me he felt like Alvy Singer not being understood by a date. As I recall, the date said: "Are you serious? Are you being serious?" and Alvy had no answer. What should he have said? "It's in the past now," he told me. A dismal state of affairs!

 

$$$

 

The Jealousy Poems

 

[A couple walks into a bar. They sit down at a table. At the table beside them, a man is writing in a notebook, and in front of him is a Rubik's cube.]

SHE: Oh, look, he has one of those cube things.

HE: Rubik's cube.

SHE: What's he writing?

HE: Something like a chart.

SHE [to OTHER]: Are you a mathematician?

OTHER: Weekends only.

SHE: You're writing about the cube?

OTHER: In a sense.

SHE [to HE]: I don't know much about them.

HE [inner voice]: If I tell her I can solve one, she'll get more interested, and talk more to this creep. [to SHE]: They were once very popular.

SHE [to OTHER]: Can you solve it?

OTHER: Quite easily. I won a competition a year ago.

HE [quickly, to SHE]: How was the subway?

SHE: [to OTHER]: Wow, a competition! That must get loud!

OTHER: Yes, lots of clacky-clacky.

HE [inner voice]: I can solve one too, it's not that difficult!

SHE [to OTHER]: You got a prize?

OTHER: First edition of a book by Raymond Smullyan.

SHE: [to OTHER]: Who's that?

HE [inner voice]: I have two of his books at home! Argh!

 

$$$

 

There is a park, and there is a bench, and we are sitting on it, checking out all the people who are almost exclusively younger than us. I don't know if I've ever been in this park before, or on this bench. He is holding forth. "I've decided the mind is like a holograph. It's shattered in pieces, but each piece contains a part of all the other pieces." I say: "Sure, why not, I guess so." He continues: Do you remember the morning you lit your thumb on fire?" I search my memory, and vaguely remember something like that. "Was I trying to fill a Zippo?" "Yes, it was a Zippo, I remember that." "These are old memories. I feel like I remember the kitchen where it happened." I get up to stretch. We haven't seen one another in thirty years, and he's talking about lighters. I told him I had two kids, but he hasn't asked anything about them. They could be dead for all he cares. Hell, I should be dead by now. "Where are you going?" he asks. "Just stretching. Over time, this holograph of yours, it will deteriorate. It will fade like a photograph." "Holograph."

 

$$$

 

"I tried a start-up once. I was fresh out of MIT, major in computer science, minor in genetics. I called it Nautilus. See, I figured there was a market in resurrecting the dead. Hasn't that been the dream for ages and ages? I had some lab rats from whom I took genetic material, and I also made 3D models of their environments, everything they'd seen their entire lives. After they died, of natural causes, I combined the DNA and the models and, using my trade secret of transformation--I can't tell you what that was!--I managed to create rats that were exactly like their sources. Parthenogenesis, like. The next step was the marketing. For a cool hundred thousand dollars, I would resurrect some widow's husbands. I felt certain there was a niche. I took out ads in all the retirement magazines. I mean, what a hundred thousand to a widow? And I waited for the orders to roll in. I didn't get a single order, and my start-up flopped."

"Maybe you were trying the wrong market."

"I don't know. I've moved onto other things in related fields. I couldn't believe it. Why wouldn't a widow want a resurrected husband?"

 

$$$

 

Like Hemingway's Orgasms

 

At a social event, doesn't matter which one, I was in a chatty group, and Erik was among us. Erik said: "I'd like to thank the hosts of this event, but I think I've finally run out of words." He looked around, one face to another, silently.

Mary said to him: "Why don't you do it yourself? What do you mean, you've run out of words?"

Erik shrugged speechlessly.

From then on, Erik never spoke again. No matter what his friends of family did, he wouldn't reply. He didn't even bother to learn how to sign in ASL. Maybe those would have been words, even though they were made with one's hands.

He couldn't work anymore. He wound up at his parent's door in a sorry state. Apparently, he went up to the room he'd been in as a boy and read everything he could get his hands on. That was how he spent the rest of his life. He read books, and that was about it. He was incommunicado to ever single person.

Erik died last week due to complications during some routine surgery. Perhaps he had truly run out of words during that social event.

 

$$$

 

My Monolith

 

I was out in the back driveway (made of dirt) which empties into an alleyway, pulling up weeds because passersby could mistake the place for an abandoned property so numerous was the foliage growing upon it, and I figured that if I cleared out a visible rectangle of plant-free space it would become obvious even from outer space that the building was not abandoned because there had to be some human intelligence thereabouts because rectangles are a sign of something slightly more meaningful than chaos. I cleared out the plants within the rectangle, and voila, the sign was finished. No-one would let his or her dog drop on our dirty driveway.

Which got me to thinking about 2001 and the monolith. It measured in ratio, as you recall, 1x4x9. But 1x4x9 what? I find now, according to a wiki on everything 2001, that the units were irrelevant. Inches, metres, feet, it could be anything. Thus, I have constructed my own monolith, although in only two dimensions, near the alley behind our house. It pales beside the fictional monoliths of A Space Odyssey, though. It can't turn anyone into a star-child because the cats wouldn't let that happen.

 

$$$

 

MMMMMMMMyyyyyyyy HHHHHHHHoooooooolllllllliiiiiiiidddddddaaaaaaayyyyyyyy TTTTTTTTiiiiiiimmmmmmmeeeeeee

 

IIIIIII dddddddiiiiiiidddddddnnnnnnn'''''''ttttttt fffffffiiiiiiinnnnnnnddddddd ttttttthhhhhhheeeeeee tttttttiiiiiiimmmmmmmeeeeeee tttttttooooooo dddddddooooooo dddddddaaaaaaaiiiiiiilllllllyyyyyyy eeeeeeennnnnnntttttttrrrrrrriiiiiiieeeeeeesssssss wwwwwwwhhhhhhheeeeeeennnnnnn IIIIIII wwwwwwwaaaaaaasssssss aaaaaaawwwwwwwaaaaaaayyyyyyy aaaaaaatttttttt aaaaaaa ssssssshhhhhhhaaaaaaaccccccckkkkkkk bbbbbbbyyyyyyy aaaaaaa lllllllaaaaaaakkkkkkkeeeeeee,,,,,,, sssssssooooooo ttttttthhhhhhhiiiiiiisssssss iiiiiiissssssss mmmmmmmmyyyyyyy wwwwwwwaaaaaaayyyyyyy ooooooofffffff mmmmmmmaaaaaaakkkkkkkiiiiiiinnnnnnnggggggg iiiiiiittttttt uuuuuuuppppppp....... IIIIIII wwwwwwwooooooouuuuuuullllllldddddddnnnnnnn'''''''ttttttt cccccccaaaaaaallllllllllllll iiiiiiittttttt cccccccllllllleeeeeeevvvvvvveeeeeeerrrrrrr,,,,,,, bbbbbbbuuuuuuuttttttt,,,,,,, wwwwwwwhhhhhhheeeeeeennnnnnn iiiiiiittttttt'''''''sssssss ooooooovvvvvvveeeeeeerrrrrrr,,,,,,, IIIIIII'''''''mmmmmmm cccccccaaaaaaalllllllllllllliiiiiiinnnnnnnggggggg iiiiiiittttttt dddddddooooooonnnnnnneeeeeee.......

WWWWWWWeeeeeee aaaaaaarrrrrrrrrrrrrriiiiiiivvvvvvveeeeeeeddddddd SSSSSSSaaaaaaatttttttuuuuuuurrrrrrrdddddddaaaaaaayyyyyyy aaaaaaafffffffttttttteeeeeeerrrrrrrnnnnnnnnnnnnnooooooooonnnnnnn,,,,,,, wwwwwwwhhhhhhheeeeeeennnnnnn ttttttthhhhhhheeeeeee ssssssstttttttooooooovvvvvvveeeeeee'''''''sssssss cccccccllllllloooooooccccccckkkkkkk hhhhhhhiiiiiiiittttttt 3333333:::::::11111116666666....... WWWWWWWWeeeeeee uuuuuuunnnnnnnpppppppaaaaaaaccccccckkkkkkkeeeeeeeddddddd eeeeeeevvvvvvveeeeeeeerrrrrrryyyyyyytttttttthhhhhhhiiiiiiinnnnnnnggggggg,,,,,,, ooooooofffffff cccccccooooooouuuuuuurrrrrrrssssssseeeeeee,,,,,,, ttttttthhhhhhheeeeeeennnnnnn wwwwwwwweeeeeeee rrrrrrreeeeeeettttttttiiiiiiirrrrrrreeeeeeeddddddd tttttttooooooo ttttttthhhhhhheeeeeee ssssssscccccccrrrrrrreeeeeeeeeeeeeennnnnnneeeeeeeddddddd-------iiiiiiinnnnnnn pppppppooooooorrrrrrrccccccchhhhhhh fffffffooooooorrrrrrr sssssssooooooommmmmmmeeeeeee pppppppllllllleeeeeeeaaaaaaasssssssaaaaaaannnnnnnttttttt bbbbbbbeeeeeeeevvvvvvveeeeeeeerrrrrrraaaaaaagggggggeeeeeeesssssss wwwwwwwiiiiiiittttttthhhhhhh aaaaaaa vvvvvvviiiiiiieeeeeeewwwwwww ooooooofffffff rrrrrrraaaaaaapppppppiiiiiiidddddddlllllllyyyyyyy-------ccccccclllllllooooooouuuuuuudddddddiiiiiiinnnnnnnggggggg sssssssskkkkkkkiiiiiiieeeeeeesssssss.......

TTTTTTThhhhhhheeeeeee wwwwwwweeeeeeeaaaaaaattttttthhhhhhheeeeeeerrrrrrr sssssssstttttttaaaaaaayyyyyyyeeeeeeeddddddd ppppppprrrrrrreeeeeeettttttttttttttyyyyyyy lllllllooooooouuuuuuusssssssyyyyyyy fffffffooooooorrrrrrr ttttttthhhhhhheeeeeee eeeeeeennnnnnntttttttiiiiiiirrrrrrreeeeeee wwwwwwweeeeeeeeeeeeeekkkkkkk,,,,,,, bbbbbbbuuuuuuuttttttt IIIIIII wwwwwwwaaaaaaasssssss ppppppphhhhhhhiiiiiiilllllllooooooosssssssoooooooppppppphhhhhhhiiiiiiicccccccaaaaaaalllllll aaaaaaabbbbbbbooooooouuuuuuuttttttt iiiiiiittttttt,,,,,,, rrrrrrreeeeeeeaaaaaasssssssooooooonnnnnnniiiiiiinnnnnnnggggggg ttttttthhhhhhhaaaaaaattttttt lllllllaaaaaaasssssssttttttt yyyyyyyeeeeeeeaaaaaaarrrrrrr,,,,,,, sssssssaaaaaaammmmmmmeeeeeeee wwwwwwweeeeeeeeeeeeeekkkkkkk ooooooofffffff ttttttthhhhhhheeeeeeee yyyyyyyeeeeeeeaaaaaaarrrrrrr mmmmmmmooooooorrrrrrreeeeeee ooooooorrrrrrr llllllleeeeeeessssssssssssss,,,,,,, hhhhhhhaaaaaaaddddddd bbbbbbbeeeeeeeeeeeeeennnnnnnn pppppppeeeeeeerrrrrrrfffffffeeeeeeecccccccttttttt ooooooonnnnnnn eeeeeeevvvvvvveeeeeeeerrrrrrryyyyyyy sssssssiiiiiiiinnnnnnnggggggggllllllleeeeeee dddddddaaaaaaayyyyyyy,,,,,,, aaaaaaannnnnnnddddddd IIIIIII fffffffiiiiiiiggggggguuuuuuurrrrrrreeeeeeeddddddd ttttttthhhhhhhiiiiiiinnnnnnngggggggsssssss bbbbbbbaaaaaaaalllllllaaaaaaannnnnnnccccccceeeeeeeddddddd tttttttthhhhhhheeeeeeeemmmmmmmmssssssseeeeeeelllllllvvvvvvveeeeeeesssssss ooooooouuuuuuuttttttt,,,,,,, ooooooonnnnnnn aaaaaaa yyyyyyyeeeeeeeaaaaaaarrrrrrr-------bbbbbbbyyyyyyy-------yyyyyyyeeeeeeeaaaaaaarrrrrrr bbbbbbbaaaaaaasssssssiiiiiiisssssss.......

TTTTTTThhhhhhheeeeeee dddddddaaaaaaayyyyyyysssssss pppppppaaaaaaasssssssssssssseeeeeeeddddddd wwwwwwwiiiiiiittttttthhhhhhh rrrrrrreeeeeeeaaaaaaadddddddiiiiiiiinnnnnnnggggggg aaaaaaannnnnnnddddddd ooooooorrrrrrriiiiiiigggggggaaaaaaammmmmmmiiiiiii....... IIIIIII cccccccooooooooooooookkkkkkkeeeeeeeddddddd tttttttwwwwwwwwiiiiiiiccccccceeeeeee eeeeeeevvvvvvveeeeeeerrrrrrryyyyyyy dddddddaaaaaaayyyyyyy;;;;;;; wwwwwwweeeeeee dddddddiiiiiiidddddddnnnnnnn'''''''ttttttt dddddddiiiiiiinnnnnnneeeeeee ooooooouuuuuuuttttttt aaaaaaattttttt aaaaaaallllllllllllll.......

BBBBBBBeeeeeeesssssssttttttt fffffffrrrrrrriiiiiiieeeeeeennnnnnndddddddsssssss aaaaaaarrrrrrrrrrrrrriiiiiiivvvvvvveeeeeeeddddddd aaaaaaafffffffttttttteeeeeeerrrrrrr fffffffiiiiiiivvvvvvveeeeeee dddddddaaaaaaayyyyyyysssssss,,,,,,, aaaaaaannnnnnnddddddd wwwwwwweeeeeee wwwwwwwhhhhhhhoooooooooooooopppppppeeeeeeeddddddd iiiiiiittttttt uuuuuuuppppppp aaaaaaannnnnnnnddddddd dddddddrrrrrrraaaaaaannnnnnnkkkkkkk aaaaaaannnnnnnddddddd ttttttthhhhhhheeeeeeerrrrrrreeeeeee mmmmmmmaaaaaaayyyyyyyy ooooooorrrrrrr mmmmmmmaaaaaaayyyyyyy nnnnnnnoooooooottttttt hhhhhhhaaaaaaavvvvvvveeeeeee bbbbbbbeeeeeeeeeeeeeennnnnnn aaaaaaaccccccctttttttiiiiiiivvvvvvviiiiiiitttttttiiiiiiieeeeeeesssssss wwwwwwwhhhhhhhiiiiiiiccccccchhhhhhh cccccccaaaaaaannnnnnnnnnnnnnooooooottttttt bbbbbbbeeeeeee tttttttooooooolllllllddddddd ooooooofffffff hhhhhhheeeeeeeerrrrrrreeeeeee pppppppaaaaaaarrrrrrrtttttttlllllllyyyyyyy bbbbbbbeeeeeeecccccccaaaaaaauuuuuuuussssssseeeeeee dddddddeeeeeeetttttttaaaaaaaiiiiiiilllllllssssssss mmmmmmmaaaaaaayyyyyyy ooooooorrrrrrr mmmmmmmaaaaaaaayyyyyyy bbbbbbbbeeeeeee aaaaaapppppppppppppprrrrrrrrooooooooppppppprrrrrrrriiiiiiiaaaaaaattttttteeeeeee fffffffooooooorrrrrrr ccccccchhhhhhhiiiiiiillllllldddddddrrrrrrreeeeeeennnnnnn aaaaaaannnnnnnddddddd bbbbbbbeeeeeeecccccccaaaaaaauuuuuuussssssseeeeeee IIIIIII ttttttthhhhhhhiiiiiiinnnnnnnkkkkkkk mmmmmmmyyyyyyy ppppppphhhhhhhooooooonnnnnnneeeeeeee'''''''sssssss tttttttaaaaaaappppppppppppppeeeeeeeddddddd.......

AAAAAAAllllllllllllll iiiiiiinnnnnnn aaaaaaallllllllllllll,,,,,,, iiiiiiittttttt wwwwwwwaaaaaaasssssss aaaaaaa dddddddeeeeeeellllllliiiiiiiggggggghhhhhhhtttttttfffffffuuuuuuullllllll wwwwwwweeeeeeeeeeeeeekkkkkkk....... NNNNNNNooooooowwwwwww IIIIIII'''''''vvvvvvveeeeeee rrrrrrreeeeeeettttttttuuuuuuurrrrrrrhhhhhhneeeeeeeddddddd,,,,,,, eeeeeeennnnnnnllllllliiiiiiiggggggghhhhhhhtttttttreeeeeeennnnnnneeeeeeeddddddd,,,,,,, aaaaaaannnnnnnddddddd eeeeeeevvvvvvveeeeeeerrrrrrryyyyyyyttttttthhhhhhhiiiiiiinnnnnnnggggggg iiiiiiisssssss cccccccoooooooopppppppaaaaaaaccccccceeeeeeetttttttiiiiiiiccccccc.......